About   Help   FAQ
Specc1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Specc1em1(IMPC)J
Name: sperm antigen with calponin homology and coiled-coil domains 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6294912
Gene: Specc1  Location: Chr11:61847589-62113839 bp, + strand  Genetic Position: Chr11, 37.96 cM
Alliance: Specc1em1(IMPC)J page
IMPC: Specc1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGAGAAGATACCTAGAGG and GTAAATTACATCAGATGATA, which resulted in a 2002 bp deletion beginning at Chromosome 11 position 62,117,560 bp and ending after 62,119,561 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000238537 (exon 4) and 419 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 95 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Specc1 Mutation:  67 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory