Specc1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Specc1em1(IMPC)J |
| Name: |
sperm antigen with calponin homology and coiled-coil domains 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6294912 |
| Gene: |
Specc1 Location: Chr11:61847589-62113839 bp, + strand Genetic Position: Chr11, 37.96 cM
|
| Alliance: |
Specc1em1(IMPC)J page
|
| IMPC: |
Specc1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGAGAAGATACCTAGAGG and GTAAATTACATCAGATGATA, which resulted in a 2002 bp deletion beginning at Chromosome 11 position 62,117,560 bp and ending after 62,119,561 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000238537 (exon 4) and 419 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 95 and early truncation 10 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|