About   Help   FAQ
Abca8aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Abca8aem1(IMPC)J
Name: ATP-binding cassette, sub-family A member 8a; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6294772
Gene: Abca8a  Location: Chr11:109916460-109986804 bp, - strand  Genetic Position: Chr11, 73.07 cM
Alliance: Abca8aem1(IMPC)J page
IMPC: Abca8a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGAGTCTTTCCTCTAAGT and GCTTACCCTATCACTACGTA, which resulted in a 1110 bp deletion beginning at Chromosome 11 position 110,071,149 bp and ending after 110,072,258 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000342464 and ENSMUSE00001068496 (exons 11 and 12) and 940 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 478 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Abca8a Mutation:  103 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory