Ltv1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ltv1em1(IMPC)J |
| Name: |
LTV1 ribosome biogenesis factor; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6294725 |
| Synonyms: |
Ltv1- |
| Gene: |
Ltv1 Location: Chr10:13054341-13068881 bp, - strand Genetic Position: Chr10, 4.72 cM
|
| Alliance: |
Ltv1em1(IMPC)J page
|
| IMPC: |
Ltv1 gene page |
|
Ltv1em1(IMPC)J/Ltv1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5, that appear as morula, but no embryos at E7.5. Mutants grown in vitro fail to hatch from the zona pellucida, never forming blastocysts.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GGGGGTAACCATGTTCTAGT and TATAGCAGTGGAGCCCAGGC that targeted exon(s) ENSMUSE00000098234.2 ENSMUSE00002136255.1. This resulted in deletion(s) of 314 bp (location: Chr10:13058535-13058848; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|