About   Help   FAQ
Ccdc85aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc85aem1(IMPC)J
Name: coiled-coil domain containing 85A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6294708
Gene: Ccdc85a  Location: Chr11:28335685-28534324 bp, - strand  Genetic Position: Chr11, 16.22 cM
Alliance: Ccdc85aem1(IMPC)J page
IMPC: Ccdc85a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCACACTCATGATATGAT and AAGAACTTACATTATCCACA, which resulted in a 365 bp deletion beginning at Chromosome 11 position 28,433,827 bp and ending after 28,434,191 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000283791 (exon 3) and 288 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 405 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc85a Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory