Rr68^em1Fjd
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr68^em1Fjd
• Name: regulatory region 68; endonuclease-mediated mutation 1, Franco J DeMayo
• MGI ID: MGI:6294276
• Synonyms: Ihh19^d
• Gene: Rr68 Location: Chr1:75010824-75011400 bp Genetic Position: Chr1, Syntenic
• Alliance: Rr68^em1Fjd page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-targeting using sgRNAs (equivalent to GGTACAGACTGGAGCCCTTA and TTATAGATAGCAGGCACTAT) deleted 577 bp (GRCm39:chr1:75010824-75011400) containing the SOX17-binding endometrial enhancer Ihh19, located 19 kb upstream of Ihh. (J:267747)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr68 Mutation: 0 strains or lines available

References

• Original: J:267747 Wang X, et al., SOX17 regulates uterine epithelial-stromal cross-talk acting via a distal enhancer upstream of Ihh. Nat Commun. 2018 Oct 24;9(1):4421
• All: 1 reference(s)