About   Help   FAQ
Zfp786em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp786em1(IMPC)J
Name: zinc finger protein 786; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6294143
Gene: Zfp786  Location: Chr6:47796200-47807801 bp, - strand  Genetic Position: Chr6, 22.94 cM
Alliance: Zfp786em1(IMPC)J page
IMPC: Zfp786 gene page
Mutation
origin
Strain of Origin:  Not Specified
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCCACCTCTAAGGACAAAC and GTAATTTGAGACTCACAGAG, which resulted in a 404 bp deletion beginning at Chromosome 6 position 47,826,784 bp and ending after 47,827,187 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001268428 (exon 2) and 277 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 8 amino acids later. There is a single bp (A) insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp786 Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory