Sec61a2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sec61a2^em1(IMPC)J
• Name: SEC61 translocon subunit alpha 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6294092
• Gene: Sec61a2 Location: Chr2:5875798-5900243 bp, - strand Genetic Position: Chr2, 3.62 cM
• Alliance: Sec61a2^em1(IMPC)J page
• IMPC: Sec61a2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGCTTTGTGGTTTTATAT and AAACACTTAGTGGAACACAA, which resulted in a 216 bp deletion beginning at Chromosome 2 position 5,886,393 bp and ending after 5,886,608 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000570184 (exon 4) and 137 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sec61a2 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)