About   Help   FAQ
Slc17a2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc17a2em1(IMPC)J
Name: solute carrier family 17 (sodium phosphate), member 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6294082
Gene: Slc17a2  Location: Chr13:23990976-24009163 bp, + strand  Genetic Position: Chr13, 9.94 cM
Alliance: Slc17a2em1(IMPC)J page
IMPC: Slc17a2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGGTTCTTAGTTAGTAG and CCTACATCAGTCAAAGGCTG, which resulted in a 640 bp deletion beginning at Chromosome 13 position 23,814,821 bp and ending after 23,815,460 bp (GRCm38/mm10). This mutation deletes ENSMUSE0000124538 and ENSMUSE00001248222 (exons 4 and 5) and 318 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc17a2 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/14/2026
MGI 6.24
The Jackson Laboratory