Dok6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dok6^em1(IMPC)J
• Name: docking protein 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6294072
• Gene: Dok6 Location: Chr18:89310548-89787652 bp, - strand Genetic Position: Chr18, 59.05 cM
• Alliance: Dok6^em1(IMPC)J page
• IMPC: Dok6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATTTCCTCAAGCTGTAGAT and GGCCAGTTATCACTACCCTA, which resulted in a 294 bp deletion beginning at Chromosome 18 position 89,559,906 bp and ending after 89,560,199 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000658810 (exon 3) and 179 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 19 amino acids later. There is a 5 bp insertion (GGTAG) 106 bp before the deletion. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dok6 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)