Spatc1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Spatc1em1(IMPC)J |
Name: |
spermatogenesis and centriole associated 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6293902 |
Gene: |
Spatc1 Location: Chr15:76152289-76176772 bp, + strand Genetic Position: Chr15, 35.63 cM, cytoband E1
|
Alliance: |
Spatc1em1(IMPC)J page
|
IMPC: |
Spatc1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAACCCCACACCAGAAGAG and CTACCCCTTTGCTAAGAACA, which resulted in a 9510 bp deletion beginning at Chromosome 15 position 76,283,317 bp and ending after 76,292,826 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000498536-ENSMUSE00000479099 (exons 2-5) and 8193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 69 and early truncation 29 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|