Gm45261^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm45261^{em1(IMPC)Wtsi}
• Name: predicted gene 45261; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6286372
• Gene: Gm45261 Location: Chr1:80427314-80439165 bp, - strand Genetic Position: Chr1, Syntenic
• Alliance: Gm45261^{em1(IMPC)Wtsi} page
• IMPC: Gm45261 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Welcome Sanger Institute by injecting CAS9 RNA and 4 guide sequences AGTTGGTCACAGCCATGTGCTGG, CCTAGTGGACATCAATGAGATGG, CCTCCAGTGGACACTCCAGGCTA, CCTTATCGATGTTAGTTGGTCAC, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gm45261 Mutation: 1 strain or line available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)