Vapb^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vapb^em1(IMPC)H
• Name: vesicle-associated membrane protein, associated protein B and C; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6285602
• Gene: Vapb Location: Chr2:173579378-173626132 bp, + strand Genetic Position: Chr2, 97.37 cM, cytoband H3
• Alliance: Vapb^em1(IMPC)H page
• IMPC: Vapb gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and 4 guides with spacer sequences CAGGATAGAGCACGCCGCTG, GGCAAACCCTTCCGGGCATG, and TTCAGCGAGAGCTGTGAGAT that targeted exon(s) ENSMUSE00001222943.2. This resulted in deletion(s) of 730 bp (location: Chr2:173612951-173613680; GRCm39) and insertion of 1 bp (location: chr2:173612949; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Vapb Mutation: 32 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)