Ddx21^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ddx21^em1(IMPC)Bay
• Name: DExD box helicase 21; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6285598
• Synonyms: Ddx21^-
• Gene: Ddx21 Location: Chr10:62416030-62438060 bp, - strand Genetic Position: Chr10, 32.43 cM, cytoband B4-B5.1
• Alliance: Ddx21^em1(IMPC)Bay page
• IMPC: Ddx21 gene page

Ddx21^em1(IMPC)Bay/Ddx21^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Some E3.5 embryos appear as morulae and others as blastocysts. Morula mutants do not hatch from the zona or form outgrowths. Blastocyst mutants hatch from the zona and form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences CAGTGCTCTAATGATTCAAG, CTTAGAACACTGCTTGGGGA, GCAAGAAACGCACATGTAAA, and TGTGCACACTTACTCCTGAG that targeted exon(s) ENSMUSE00001038863.2. This resulted in deletion(s) of 471 bp (location: Chr10:62428648-62429118; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ddx21 Mutation: 38 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)