Ddx21em1(IMPC)Bay
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ddx21em1(IMPC)Bay |
| Name: |
DExD box helicase 21; endonuclease-mediated mutation 1, Baylor College of Medicine |
| MGI ID: |
MGI:6285598 |
| Synonyms: |
Ddx21- |
| Gene: |
Ddx21 Location: Chr10:62416030-62438060 bp, - strand Genetic Position: Chr10, 32.43 cM, cytoband B4-B5.1
|
| Alliance: |
Ddx21em1(IMPC)Bay page
|
| IMPC: |
Ddx21 gene page |
|
Ddx21em1(IMPC)Bay/Ddx21em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Some E3.5 embryos appear as morulae and others as blastocysts. Morula mutants do not hatch from the zona or form outgrowths. Blastocyst mutants hatch from the zona and form outgrowths.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences CCATCCCCAAGCAGTGTTCTAAG, CCACTCAGGAGTAAGTGTGCACA, GCAAGAAACGCACATGTAAAAGG, CCTCTTGAATCATTAGAGCACTG, which resulted in a Exon Deletion.
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
4 reference(s) |
|