About   Help   FAQ
Tifaem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tifaem1(IMPC)J
Name: TRAF-interacting protein with forkhead-associated domain; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6284822
Gene: Tifa  Location: Chr3:127582524-127592043 bp, + strand  Genetic Position: Chr3, 56.54 cM
Alliance: Tifaem1(IMPC)J page
IMPC: Tifa gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCAGTCTTATAATGTGGA and GACTGGTGATCTGCAGCAAG, which resulted in a 2018 bp deletion beginning at Chromosome 3 position 127,796,415 bp and ending after 127,798,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001352154 (exon 3) and 197 bp of flanking intronic sequence including the splice acceptor and start of translation and is predicted to result in a null allele. (J:188991, J:384794)
Inheritance:    Not Specified
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tifa Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory