Ntmt2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ntmt2^em1(IMPC)J
• Name: N-terminal Xaa-Pro-Lys N-methyltransferase 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6284511
• Gene: Ntmt2 Location: Chr1:163529825-163552801 bp, - strand Genetic Position: Chr1, 71.0 cM
• Alliance: Ntmt2^em1(IMPC)J page
• IMPC: Ntmt2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTCCAGCTCTATCCCTAG and TTTGTTGTACACGTGTTTAT, which resulted in a 596 bp deletion beginning at Chromosome 1 position 163,703,825 bp and ending after 163,704,420 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000853217 (exon 3) and 250 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 111 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ntmt2 Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)