About   Help   FAQ
Cntnap5bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cntnap5bem1(IMPC)J
Name: contactin associated protein-like 5B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6284505
Gene: Cntnap5b  Location: Chr1:99700490-100413667 bp, + strand  Genetic Position: Chr1, 48.19 cM
Alliance: Cntnap5bem1(IMPC)J page
IMPC: Cntnap5b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGTGGTATGCCCTGTAGA and TAGCCCAGCTAAGATAAAG, which resulted in a 385 bp deletion beginning at Chromosome 1 position 100,075,903 bp and ending after 100,076,287 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000965671 (exon 6) and 200 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 244 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cntnap5b Mutation:  75 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory