Orc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Orc2^em1(IMPC)J
• Name: origin recognition complex, subunit 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6284488
• Synonyms: Orc2^-
• Gene: Orc2 Location: Chr1:58501933-58544114 bp, - strand Genetic Position: Chr1, 29.1 cM
• Alliance: Orc2^em1(IMPC)J page
• IMPC: Orc2 gene page

Orc2^em1(IMPC)J/Orc2^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form in vitro outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCAAACTCATCAAATTCCG and GTTGTACTCTTAATGTAGGT, which resulted in a 1259 bp deletion beginning at Chromosome 1 position 58,492,609 bp. There is a 6 bp endogenous retention (CTACAT) after 58,493,784 followed by 74 bp of the deletion and ending after 58,493,873 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000155147 and ENSMUSE00000238668 (exons 6 and 7) and 1137 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 109 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Orc2 Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)