Orc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Orc2^em1(IMPC)J
• Name: origin recognition complex, subunit 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6284488
• Synonyms: Orc2^-
• Gene: Orc2 Location: Chr1:58501933-58544114 bp, - strand Genetic Position: Chr1, 29.1 cM
• Alliance: Orc2^em1(IMPC)J page
• IMPC: Orc2 gene page

Orc2^em1(IMPC)J/Orc2^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form in vitro outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACCAAACTCATCAAATTCCG and GTTGTACTCTTAATGTAGGT that targeted exon(s) ENSMUSE00000155147.4 ENSMUSE00000238668.4. This resulted in deletion(s) of 74 bp (location: Chr1:58531768-58531841; GRCm39), 1185 bp (location: Chr1:58531848-58533032; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Orc2 Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)