About   Help   FAQ
Slc6a16em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc6a16em1(IMPC)J
Name: solute carrier family 6, member 16; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6284361
Gene: Slc6a16  Location: Chr7:44890509-44922791 bp, + strand  Genetic Position: Chr7, 29.22 cM
Alliance: Slc6a16em1(IMPC)J page
IMPC: Slc6a16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGCCAGTGACGGATGCG and CTAACATTAGAAAGCTCCAG, which resulted in a 1706 bp deletion beginning at Chromosome 7 position 45,259,727 bp and ending after 45,261,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001034222 and ENSMUSE00000967546 (exons 4 and 8) and 892 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acids 160. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc6a16 Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory