Slc6a16^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc6a16^em1(IMPC)J
• Name: solute carrier family 6, member 16; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6284361
• Gene: Slc6a16 Location: Chr7:44890509-44922791 bp, + strand Genetic Position: Chr7, 29.22 cM
• Alliance: Slc6a16^em1(IMPC)J page
• IMPC: Slc6a16 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGCCAGTGACGGATGCG and CTAACATTAGAAAGCTCCAG, which resulted in a 1706 bp deletion beginning at Chromosome 7 position 45,259,727 bp and ending after 45,261,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001034222 and ENSMUSE00000967546 (exons 4 and 8) and 892 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acids 160. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc6a16 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)