Mamdc2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mamdc2em1(IMPC)J |
| Name: |
MAM domain containing 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6283570 |
| Gene: |
Mamdc2 Location: Chr19:23279973-23425806 bp, - strand Genetic Position: Chr19, 18.22 cM
|
| Alliance: |
Mamdc2em1(IMPC)J page
|
| IMPC: |
Mamdc2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGTGTTCTATGCTATATG and CTTGCATTGCATCATCCCAA, which resulted in a 446 bp deletion beginning at Chromosome 19 position 23,378,605 bp and ending after 23,379,050 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349008 (exon 3) and 174 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 13 amino acids later. There is a single bp (T) insertion at the deletion site.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|