About   Help   FAQ
Surf4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Surf4em1(IMPC)J
Name: surfeit gene 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6283514
Gene: Surf4  Location: Chr2:26810052-26823801 bp, - strand  Genetic Position: Chr2, 19.1 cM
Alliance: Surf4em1(IMPC)J page
IMPC: Surf4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCACACATAGCTTCTCAA and GCAGGTCCAGTGCCTTGCCA, which resulted in a 441 bp deletion beginning at Chromosome 2 position 26,926,633 bp and ending after 26,927,073 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000232711 (exon 2) and 254 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 16 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Surf4 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory