Entrep2em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Entrep2em1(IMPC)Wtsi |
| Name: |
endosomal transmembrane epsin interactor 2; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute |
| MGI ID: |
MGI:6281942 |
| Gene: |
Entrep2 Location: Chr7:64405839-64806276 bp, - strand Genetic Position: Chr7, 34.7 cM
|
| Alliance: |
Entrep2em1(IMPC)Wtsi page
|
| IMPC: |
Entrep2 gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences GGAGGCACAAGTATCTGTACTGG, CTCGTATGGCTGGTGGCCAATGG, CTTCATTCCCTGTCCGTAGGAGG, GCATTATCCCAGATCTCGTATGG, which resulted in a Exon Deletion.
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Entrep2 Mutation: |
25 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
1 reference(s) |
|