About   Help   FAQ
Arhgap10em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Arhgap10em1(IMPC)Tcp
Name: Rho GTPase activating protein 10; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6281939
Gene: Arhgap10  Location: Chr8:77976995-78244582 bp, - strand  Genetic Position: Chr8, 36.6 cM, cytoband C2
Alliance: Arhgap10em1(IMPC)Tcp page
IMPC: Arhgap10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1260 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs with spacer sequences of TAAAAGAGCCATCTACGGGG and GTGTAAAACAGTCAATCGAG targeting the 5' side and CTTCGATCTGAAGAGTCGGG and GCACATCACTAGATAGCATG targeting the 3' side of a critical exon. This resulted in a 5-bp deletion on Chr8: 77413906 to 77413910, a 351-bp deletion on Chr8: 77413460 to 77413810, and a 3-bp deletion Chr8: 77413310 to 77413312 (GRCm38). (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Arhgap10 Mutation:  51 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory