Slco1a6^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slco1a6^{em1(IMPC)Wtsi}
• Name: solute carrier organic anion transporter family, member 1a6; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6281935
• Gene: Slco1a6 Location: Chr6:142031487-142131903 bp, - strand Genetic Position: Chr6, 73.42 cM
• Alliance: Slco1a6^{em1(IMPC)Wtsi} page
• IMPC: Slco1a6 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences TTGGACTCTAGGGCTCGTTGAGG, CCTTCCCAACATTTGGACTCTAG, GAACATTGCTTCTCCCAGAGAGG, ACTGGATTTATACTCAAAGAAGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slco1a6 Mutation: 39 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)