About   Help   FAQ
Ces3bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ces3bem1(IMPC)J
Name: carboxylesterase 3B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6281171
Gene: Ces3b  Location: Chr8:105810385-105820561 bp, + strand  Genetic Position: Chr8, 53.04 cM
Alliance: Ces3bem1(IMPC)J page
IMPC: Ces3b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGGGGCTAGAGTCCTAGCA and GGAAATATAGGAATCCGTTG, which resulted in an 863 bp deletion beginning at Chromosome 8 position 105,086,311 bp and ending after 105,087,173 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001069220 and ENSMUSE00000506460 (exons 5 and 6) and 604 of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 189 and early truncation 34 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ces3b Mutation:  27 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/14/2026
MGI 6.24
The Jackson Laboratory