About   Help   FAQ
Chd1em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Chd1em1(IMPC)Wtsi
Name: chromodomain helicase DNA binding protein 1; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6281097
Synonyms: Chd1em3(IMPC)Wtsi
Gene: Chd1  Location: Chr17:15925229-15992872 bp, + strand  Genetic Position: Chr17, 8.95 cM
Alliance: Chd1em1(IMPC)Wtsi page
IMPC: Chd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated
Mutation:    Single point mutation
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 Protein, the guide sequence CCCTTCTGTACAAAACTTTAATC, and a donor oligo, which resulted in a Point Mutation allele. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Chd1 Mutation:  92 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory