About   Help   FAQ
Zfp423em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp423em1(IMPC)J
Name: zinc finger protein 423; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6280645
Gene: Zfp423  Location: Chr8:88388438-88686223 bp, - strand  Genetic Position: Chr8, 42.29 cM, cytoband C4
Alliance: Zfp423em1(IMPC)J page
IMPC: Zfp423 gene page
Mutation
origin
Strain of Origin:  Not Specified
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGCATGTGTGCTTCCTAG and GCAGCTGGCCAACTGCTGCA, which resulted in a 3279 bp deletion beginning at Chromosome 8 position 87,780,106 bp and ending after 87,783,384 bp (GRCm38/mm10). This mutation deletes all but the first 29 bp of ENSMUSE00001238707 (exon 4) and 93 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 111 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp423 Mutation:  276 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory