Zfp30^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp30^em1(IMPC)Bay
• Name: zinc finger protein 30; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6279913
• Gene: Zfp30 Location: Chr7:29483423-29494127 bp, + strand Genetic Position: Chr7, 17.26 cM
• Alliance: Zfp30^em1(IMPC)Bay page
• IMPC: Zfp30 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Baylor College of Medicine using D10A and guides with spacer sequences CTTATGAATTCGCTGATGGT and TACGGTGATGTTCAGAGATG that targeted exon(s) ENSMUSE00000200760.2 ENSMUSE00000708734.2 ENSMUSE00000721891.2 ENSMUSE00001302563.2. This resulted in deletion(s) of 5640 bp (location: Chr7:29487488-29493127; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp30 Mutation: 25 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)