About   Help   FAQ
Dok4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dok4em1(IMPC)J
Name: docking protein 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6278523
Gene: Dok4  Location: Chr8:95590456-95602940 bp, - strand  Genetic Position: Chr8, 46.93 cM, cytoband C5
Alliance: Dok4em1(IMPC)J page
IMPC: Dok4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGCGACCTACTCCACTAA and GCTTAGAGAAAACCTTAGGA, which resulted in a 625 bp deletion beginning at Chromosome 8 position 94,867,008 bp and ending after 94,867,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000287473 and ENSMUSE00000287448 (exons 3 and 4) and 402 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 23 and early truncation 36 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dok4 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory