Cox18^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cox18^em1(IMPC)J
• Name: cytochrome c oxidase assembly protein 18; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6278517
• Gene: Cox18 Location: Chr5:90362583-90371860 bp, - strand Genetic Position: Chr5, 44.32 cM
• Alliance: Cox18^em1(IMPC)J page
• IMPC: Cox18 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAATCACTATGCTGCATGG and GTTGTTTGATGAGTTCATAA, which resulted in a 241 bp deletion beginning at Chromosome 5 position 90,222,124 bp and ending after 90,222,364 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000542644 (exon 2) and 140 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 108 and early truncation 17 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cox18 Mutation: 7 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)