About   Help   FAQ
Gipc2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gipc2em1(IMPC)J
Name: GIPC PDZ domain containing family, member 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6278289
Gene: Gipc2  Location: Chr3:151799476-151871537 bp, - strand  Genetic Position: Chr3, 76.97 cM
Alliance: Gipc2em1(IMPC)J page
IMPC: Gipc2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGCCTCTTAGATAAACAA and CAGGTGTGACAGGTACGCAG, which resulted in a 637 bp deletion beginning at Chromosome 3 position 152,127,850 bp and ending after 152,128,486 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000260054 (exon 3) and 456 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 142 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gipc2 Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory