About   Help   FAQ
Cwh43em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cwh43em1(IMPC)J
Name: cell wall biogenesis 43 C-terminal homolog; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6277995
Gene: Cwh43  Location: Chr5:73563418-73610778 bp, + strand  Genetic Position: Chr5, 38.78 cM
Alliance: Cwh43em1(IMPC)J page
IMPC: Cwh43 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATAAGAACTGTGTCTAGTA and CAATGGTCAGAACTTCGCCA, which resulted in a 259 bp deletion beginning at Chromosome 5 position 73,411,781 bp and ending after 73,412,039 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000186304 (exon 3) and 138 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 23 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cwh43 Mutation:  44 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory