Irs2em1(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Irs2em1(IMPC)H |
| Name: |
insulin receptor substrate 2; endonuclease-mediated mutation 1, Harwell |
| MGI ID: |
MGI:6277062 |
| Gene: |
Irs2 Location: Chr8:11034681-11058458 bp, - strand Genetic Position: Chr8, 5.35 cM
|
| Alliance: |
Irs2em1(IMPC)H page
|
| IMPC: |
Irs2 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences GCGACGAGGCATCCGCGGCT and GGCCGCGGATGCCAGTAGTG that targeted exon(s) ENSMUSE00001566300.1 ENSMUSE00001566303.1 ENSMUSE00001566307.1 ENSMUSE00002191042.1. This resulted in deletion(s) of 3000 bp (location: Chr8:11055642-11058641; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|