H4c16^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: H4c16^em1(IMPC)Mbp
• Name: H4 histone 16; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6277028
• Gene: H4c16 Location: Chr6:136780991-136781429 bp, - strand Genetic Position: Chr6, 66.72 cM, cytoband G1
• Alliance: H4c16^em1(IMPC)Mbp page
• IMPC: H4c16 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Mutation details: This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences AGCAGGTCCCAGGCGGTAGGCGG, GAGCTTATATTTCCTGGGAGCGG, which resulted in a Whole-gene deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any H4c16 Mutation: 8 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)