Dlstem1(IMPC)Hmgu
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dlstem1(IMPC)Hmgu |
| Name: |
dihydrolipoamide S-succinyltransferase; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH |
| MGI ID: |
MGI:6277023 |
| Gene: |
Dlst Location: Chr12:85157597-85180865 bp, + strand Genetic Position: Chr12, 39.55 cM, cytoband D3
|
| Alliance: |
Dlstem1(IMPC)Hmgu page
|
| IMPC: |
Dlst gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences GGCATATCTGCGTGCTGCAG, GTTAAAGAAACCTAATTGGG, TACCACCTTGCTATAATAGT, and TCCTCGGCTCCAAGGGGGTA that targeted exon(s) ENSMUSE00000115951.4 ENSMUSE00000115954.4 ENSMUSE00000115959.4 ENSMUSE00000115961.4 ENSMUSE00001418667.2 ENSMUSE00001848488.1 ENSMUSE00001848526.1 ENSMUSE00002101904.1. This resulted in deletion(s) of 1653 bp (location: Chr12:85164805-85166457; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
5 reference(s) |
|