About   Help   FAQ
Slc9b1em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc9b1em1(IMPC)Mbp
Name: solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6277003
Gene: Slc9b1  Location: Chr3:135053790-135103588 bp, + strand  Genetic Position: Chr3, 62.55 cM, cytoband H2
Alliance: Slc9b1em1(IMPC)Mbp page
IMPC: Slc9b1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences CCTGCAGGAGAGGCTCGCTTGTT, CCTCAGATGGCAAGCTCTGATCT, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc9b1 Mutation:  32 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory