About   Help   FAQ
Nup155em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Nup155em1(IMPC)Mbp
Name: nucleoporin 155; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6276986
Synonyms: Nup155-
Gene: Nup155  Location: Chr15:8138757-8190731 bp, + strand  Genetic Position: Chr15, 3.82 cM, cytoband A2
Alliance: Nup155em1(IMPC)Mbp page
IMPC: Nup155 gene page
Nup155em1(IMPC)Mbp/Nup155em1(IMPC)Mbp mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts grown in vitro do not hatch from the zona pellucida or form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences CCTCGACTGCTTGTTGCATCTCG, ATGGTATGCAGATAGGTATGAGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nup155 Mutation:  94 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory