Mxd3^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mxd3^em1(IMPC)Mbp
• Name: Max dimerization protein 3; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6276958
• Gene: Mxd3 Location: Chr13:55472981-55477636 bp, - strand Genetic Position: Chr13, 29.8 cM
• Alliance: Mxd3^em1(IMPC)Mbp page
• IMPC: Mxd3 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences AACTCCAATAGATGTGCGGG and AGAGTTAGATGGGACAGCTA that targeted exon(s) ENSMUSE00000118245.4. This resulted in deletion(s) of 2 bp (location: Chr13:55476834-55476835; GRCm39), 28 bp (location: Chr13:55476893-55476920; GRCm39), and 328 bp (location: Chr13:55477034-55477361; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mxd3 Mutation: 10 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)