About   Help   FAQ
Taf12em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Taf12em1(IMPC)Mbp
Name: TATA-box binding protein associated factor 12; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6276947
Synonyms: Taf12-
Gene: Taf12  Location: Chr4:132001667-132020640 bp, + strand  Genetic Position: Chr4, 65.09 cM
Alliance: Taf12em1(IMPC)Mbp page
IMPC: Taf12 gene page
Taf12em1(IMPC)Mbp/Taf12em1(IMPC)Mbp mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro hatch from the zona pellucida but outgrowths lack an obvious inner cell mass colony.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences CCTTCAGCGCTAATCAACCTCTC, CCGTGGGGAAGATAGCAGGCACT, which resulted in an Intra-exdel deletion. A 90bp deletion of bases 23 to 113 of the protein coding sequence was verified by RNA sequencing. This alteration is predicted to cause early truncation after 7 amino acids. Although mutant mRNA is produced, a mutant protein likely retains no TAF12 functions based on early missense amino acids and early termination. (J:265051, J:348275)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 40 assay results
1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Taf12 Mutation:  16 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory