About   Help   FAQ
Or52h1em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Or52h1em1(IMPC)Mbp
Name: olfactory receptor family 52 subfamily H member 1; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6276914
Gene: Or52h1  Location: Chr7:103828663-103829613 bp, - strand  Genetic Position: Chr7, 55.16 cM
Alliance: Or52h1em1(IMPC)Mbp page
IMPC: Or52h1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences CCACGTTGTCACCTAGCCTAAGA, CCATGAGACTAAGTATTGCATAG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Or52h1 Mutation:  18 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory