About   Help   FAQ
Dio1em1(IMPC)Hmgu
Endonuclease-mediated Allele Detail
Summary
Symbol: Dio1em1(IMPC)Hmgu
Name: deiodinase, iodothyronine, type I; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
MGI ID: MGI:6276908
Gene: Dio1  Location: Chr4:107148662-107164365 bp, - strand  Genetic Position: Chr4, 50.18 cM
Alliance: Dio1em1(IMPC)Hmgu page
IMPC: Dio1 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details:  This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences CAGTTGTCAGGGGCGAATCG and GGTTTGTCCTGAAGGTCCGC that targeted exon(s) ENSMUSE00000521559.2 ENSMUSE00000671005.2. This resulted in deletion(s) of 65 bp (location: Chr4:107164085-107164149; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dio1 Mutation:  16 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory