Cstf1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cstf1^em1(IMPC)J
• Name: cleavage stimulation factor, 3' pre-RNA, subunit 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6276278
• Gene: Cstf1 Location: Chr2:172212601-172224368 bp, + strand Genetic Position: Chr2, 94.84 cM
• Alliance: Cstf1^em1(IMPC)J page
• IMPC: Cstf1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCTGGTTAGAGCAAGTGAA and TTAGATAAGATGCCATTGAG, which resulted in a 868 bp deletion beginning at Chromosome 2 position 172,375,477 bp and ending after 172,376,344 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000170107 and ENSMUSE00000170105 (exons 3 and 4) and 392 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 28 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cstf1 Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)