About   Help   FAQ
4933402J07Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: 4933402J07Rikem1(IMPC)J
Name: RIKEN cDNA 4933402J07 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6275630
Gene: 4933402J07Rik  Location: Chr8:88290535-88315825 bp, + strand  Genetic Position: Chr8, 42.21 cM
Alliance: 4933402J07Rikem1(IMPC)J page
IMPC: 4933402J07Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCTCCTATTTAGAGACAGT and GGTTGTTAGGGAATCACCCA, which resulted in a 950 bp deletion beginning at Chromosome 8 position 87,567,814 bp and ending after 87,568,763 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000581161 and ENSMUSE00000581160 (exons 2 and 3) and 721 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any 4933402J07Rik Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory