Zfp507^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp507^em1(IMPC)J
• Name: zinc finger protein 507; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6275176
• Gene: Zfp507 Location: Chr7:35471768-35502428 bp, - strand Genetic Position: Chr7, 21.37 cM
• Alliance: Zfp507^em1(IMPC)J page
• IMPC: Zfp507 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGAAAGCAACAGGCGCTG and TTAGTTCTAGAATCTCAAGG, which resulted in a 2580 bp deletion beginning at Chromosome 7 position 35,793,294 bp and ending after 35,795,873 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000394835 (exon 3) and 484 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to remove the first 698 amino acids but retain the last 248 before the stop. In addition, there is a 2 bp insertion (GA) 14 bp before the deletion. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp507 Mutation: 45 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)