Adi1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Adi1em1(IMPC)J |
| Name: |
acireductone dioxygenase 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6275158 |
| Gene: |
Adi1 Location: Chr12:28725230-28732174 bp, + strand Genetic Position: Chr12, 11.05 cM
|
| Alliance: |
Adi1em1(IMPC)J page
|
| IMPC: |
Adi1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGAACTGGAATTTCCACC and GCGAGGCAGCATTATCTACA, which resulted in a 2357 bp deletion beginning at Chromosome 12 position 28,677,511 bp and ending after 28,679,867 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000107236 and ENSMUSE00000107235 (exons 2 and 3) and 2057 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40, remove 100 amino acids and retain the last 39 amino acids before the stop. In addition there is a 20 bp AGATACTTATGCTGCCTAGC insertion at the deletion site.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|