About   Help   FAQ
C2cd2lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: C2cd2lem1(IMPC)J
Name: C2 calcium-dependent domain containing 2-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6275144
Gene: C2cd2l  Location: Chr9:44220534-44231579 bp, - strand  Genetic Position: Chr9, 24.84 cM, cytoband B
Alliance: C2cd2lem1(IMPC)J page
IMPC: C2cd2l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTGGTGCACAGCATGCCG and AACAGTGTCAGGCACTGCGG, which resulted in a 1299 bp deletion beginning at Chromosome 9 position 44,315,851 bp and ending after 44,317,149 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000216722-ENSMUSE00000216734 (exons 3-7) and 730 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 150 and early truncation 22 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any C2cd2l Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory