C2cd2lem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
C2cd2lem1(IMPC)J |
| Name: |
C2 calcium-dependent domain containing 2-like; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6275144 |
| Gene: |
C2cd2l Location: Chr9:44220534-44231579 bp, - strand Genetic Position: Chr9, 24.84 cM, cytoband B
|
| Alliance: |
C2cd2lem1(IMPC)J page
|
| IMPC: |
C2cd2l gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTGGTGCACAGCATGCCG and AACAGTGTCAGGCACTGCGG, which resulted in a 1299 bp deletion beginning at Chromosome 9 position 44,315,851 bp and ending after 44,317,149 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000216722-ENSMUSE00000216734 (exons 3-7) and 730 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 150 and early truncation 22 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|