Ubl7^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ubl7^em1(IMPC)Tcp
• Name: ubiquitin-like 7 (bone marrow stromal cell-derived); endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6274930
• Gene: Ubl7 Location: Chr9:57818262-57837251 bp, + strand Genetic Position: Chr9, 31.63 cM, cytoband C
• Alliance: Ubl7^em1(IMPC)Tcp page
• IMPC: Ubl7 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1236 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGTGGTGCTTACATTCTTAG and TCTATCATTACCATAACTGT targeting the 5' side and GTGCCATTCCTCACACGGTC and GAAGCGGCAAGGGCTGCTTA targeting the 3' side of a critical region. This resulted in a mutation in Chr9: 57919179_insT; 1417-bp del Chr9: 57919248 to 57920718 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ubl7 Mutation: 25 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)