Ankrd24^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ankrd24^em1(IMPC)J
• Name: ankyrin repeat domain 24; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6274400
• Gene: Ankrd24 Location: Chr10:81464374-81483444 bp, + strand Genetic Position: Chr10, 39.72 cM, cytoband C1
• Alliance: Ankrd24^em1(IMPC)J page
• IMPC: Ankrd24 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGCACACCCAGAGGTGCGA and ATGGAAGGACCGTCCCTGGG, which resulted in a 339 bp deletion beginning at Chromosome 10 position 81,634,842 bp and ending after 81,635,180 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001232215 and ENSMUSE00001292617 (exons 3 and 4) and 119 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 16 amino acids later. (J:188991, J:384794)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ankrd24 Mutation: 47 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)