About   Help   FAQ
Ccdc172em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc172em1(IMPC)J
Name: coiled-coil domain containing 172; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6274357
Gene: Ccdc172  Location: Chr19:58500424-58541517 bp, + strand  Genetic Position: Chr19, 54.35 cM, cytoband D3
Alliance: Ccdc172em1(IMPC)J page
IMPC: Ccdc172 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAACAAGCTGTCCAGACGT and TTCCAGGTCAGCGTGTGTAA, which resulted in a 2258 bp deletion beginning at Chromosome 19 position 58,525,572 bp and ending after 58,527,829 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000147905 and ENSMUSE00000147900 (exons 4,5) and 1975 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc172 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory