Ccdc172^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc172^em1(IMPC)J
• Name: coiled-coil domain containing 172; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6274357
• Gene: Ccdc172 Location: Chr19:58500424-58541517 bp, + strand Genetic Position: Chr19, 54.35 cM, cytoband D3
• Alliance: Ccdc172^em1(IMPC)J page
• IMPC: Ccdc172 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAACAAGCTGTCCAGACGT and TTCCAGGTCAGCGTGTGTAA, which resulted in a 2258 bp deletion beginning at Chromosome 19 position 58,525,572 bp and ending after 58,527,829 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000147905 and ENSMUSE00000147900 (exons 4,5) and 1975 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc172 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)