About   Help   FAQ
Abhd14bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Abhd14bem1(IMPC)J
Name: abhydrolase domain containing 14b; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6274308
Gene: Abhd14b  Location: Chr9:106324936-106330122 bp, + strand  Genetic Position: Chr9, 57.53 cM, cytoband F1
Alliance: Abhd14bem1(IMPC)J page
IMPC: Abhd14b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGGGTGTTACGTGAACCT and GCCCACAGTGGCAGTCCCAA, which resulted in a 1906 bp deletion beginning at Chromosome 9 position 106,451,319 bp and ending after 106,453,224 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374711 and ENSMUSE00000345857 (exons 3 and 4) and 724 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 33 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Abhd14b Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory