Abhd14b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Abhd14b^em1(IMPC)J
• Name: abhydrolase domain containing 14b; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6274308
• Gene: Abhd14b Location: Chr9:106324936-106330122 bp, + strand Genetic Position: Chr9, 57.53 cM, cytoband F1
• Alliance: Abhd14b^em1(IMPC)J page
• IMPC: Abhd14b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACTGGGTGTTACGTGAACCT and GCCCACAGTGGCAGTCCCAA that targeted exon(s) ENSMUSE00000345857.10 ENSMUSE00001321505.2 ENSMUSE00001321958.2 ENSMUSE00001374711.2 ENSMUSE00001393881.2 ENSMUSE00001398121.2 ENSMUSE00001401293.2 ENSMUSE00001401483.2 ENSMUSE00001402945.2 ENSMUSE00001607217.1. This resulted in deletion(s) of 1906 bp (location: Chr9:106328518-106330423; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Abhd14b Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)