About   Help   FAQ
Metrnem2(IMPC)Ics
Endonuclease-mediated Allele Detail
Summary
Symbol: Metrnem2(IMPC)Ics
Name: meteorin, glial cell differentiation regulator; endonuclease-mediated mutation 2, Mouse Clinical Institute
MGI ID: MGI:6273960
Gene: Metrn  Location: Chr17:26013545-26016019 bp, - strand  Genetic Position: Chr17, 12.89 cM, cytoband A3.3
Alliance: Metrnem2(IMPC)Ics page
IMPC: Metrn gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Institut Clinique de la Souris by injecting CAS9 RNA, 2 guide sequences CCTGCTCTTTTCCTAAACCGAAT, TGCGTTTCCTCAGTTCCAAGTGG, and a non-contributing oligo, which resulted in a Conditional Ready allele. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Metrn Mutation:  21 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory